Canchao YANG, Wei LIANG, Anton ANTONOV, Yan CAI, Bård G. STOKKE, Frode FOSSØY, Arne MOKSNES, Eivin RØSKAFT. 2012: Diversity of parasitic cuckoos and their hosts in China. Avian Research, 3(1): 9-32. DOI: 10.5122/cbirds.2012.0004
Citation: Canchao YANG, Wei LIANG, Anton ANTONOV, Yan CAI, Bård G. STOKKE, Frode FOSSØY, Arne MOKSNES, Eivin RØSKAFT. 2012: Diversity of parasitic cuckoos and their hosts in China. Avian Research, 3(1): 9-32. DOI: 10.5122/cbirds.2012.0004

Diversity of parasitic cuckoos and their hosts in China

More Information
  • Corresponding author:

    Wei LIANG, E-mail: liangwei@hainnu.edu.cn

  • Received Date: 05 Jan 2012
  • Accepted Date: 27 Feb 2012
  • Available Online: 23 Apr 2023
  • In this exposé we provide the first review of host use by brood parasitic cuckoos in a multiple-cuckoo system in China, based on our own long-term field data and a compilation of observations obtained from the literature. In total, we found that 11 species of cuckoos utilized altogether 55 host species. These hosts belong to 15 families, in which Sylviidae, Turdidae and Timaliidae account for 22.6%, 20.8% and 17.0% of parasitism records, respectively. The Common Cuckoo (Cuculus canorus) had the widest range of host species, accounting for 45.5% of the total number of parasitized species (25 in 10 families) of all parasitism records and is the most frequent brood parasite in the country. Cuckoo species differed in their egg coloration and the extent of egg polymorphism with most of them, e.g. the Common Cuckoo, the Lesser Cuckoo (C. poliocephalus) and the Plaintive Cuckoo (Cacomantis merulinus) laying well mimetic eggs with respect to their hosts based on human being's visual observations, while others such as the Large Hawk-cuckoo (C. sparverioides), the Himalayan Cuckoo (C. saturatus) and the Asian Emerald Cuckoo (Chrysococcyx maculatus) usually laid non-mimetic eggs. The use of cuckoo hosts and egg color variation in China are compared with those in other parts of their ranges in Asia.

  • Reintroduction of animals into an existing remnant wild population is an important technique for the successful conservation management of endangered species and locally declining populations (Frankham et al., 2002; Armstrong and Seddon, 2008). Many endangered species are often incapable of long-term survival in highly fragmented and isolated, human-disturbed natural habitats and ex situ conservation programs such as captive breeding are required to preserve them and provide suitable animals to supplement wild remnant populations (Tenhumberg et al., 2004; Robert, 2009). The success of these reintroduction programs is difficult to assess, but ideally they should be judged on the re-establishment of a long-term viable (self-sustaining) wild population (Griffith et al., 1989; Fischer and Lindenmayer, 2000). However, the use of captive propagation for reintroduction programs is not without risk. Generally, most captive populations are significantly smaller than remnant wild populations (Jiang et al., 2005) and evidence suggests that captive-bred populations tend to have lower genetic variability than that of the remnant populations (Jiang et al., 2005). This could result in genetic changes that may reduce the long-term viability of remnant wild populations (Lynch and O'Hely, 2001; Reed et al., 2007; Miller et al., 2009). The genetic integrity of both the remnant wild populations and a captive population therefore needs to be carefully assessed (Araki et al., 2007) prior to reintroduction.

    Cabot's Tragopan (Tragopan caboti) is a globally threatened species, restricted to montane (subtropical) forests in southeastern China (800–1800 m in elevation) (Zhang and Zheng, 2007; Zhang, 2010). Currently listed as 'Vulnerable' (BirdLife International, 2008), CITES Appendix I (IUCN, 2008) and the first category of nationally protected wildlife species in China (Zheng and Wang, 1998), this species has been the subject of a long-term monitoring program since 1983 at one of its remaining strongholds in the Wuyi-Yandang Mountain range (e.g. Zheng et al., 1985; Young et al., 1991; Qian and Zheng, 1993; Ding and Zheng, 1997; Deng and Zheng, 2004; Zhang, 2005; Sun et al., 2009). Subtropical forest habitat continues to be reduced and degraded in the area through agricultural expansion and consequently, these forests now represent isolated population refugia (Zhang and Zheng, 2007). Cabot's Tragopan appears intolerant of the surrounding matrix habitat, consisting largely of secondary bamboo forests and agricultural land forms. The probability of its dispersal is directly related to the degree of subtropical forest fragmentation (Zhang and Zheng, 2007). Suitable habitat patches separated by distances of > 500 m appear to represent a threshold in the dispersal probabilities of the species, beyond which movement and dispersal is significantly reduced (Deng and Zheng, 2004). This raises important concerns regarding the risk of genetic isolation and inbreeding within the Wuyi-Yandang population and therefore the ability of the species to persist in fragmented landscapes. A recent population viability analysis (PVA) has demonstrated that the probability of the remnant Wuyi-Yandang population persisting over the long term will decrease markedly even with a reduction in the rate of deforestation (Zhang and Zheng, 2007).

    Since 1985 and simultaneous with the long-term monitoring program of the wild population, a captive breeding program for T. caboti was established by the Tragopan Breeding Center of Beijing Normal University (TBCBNU; Zhang, 2006). The aim of this program is to maintain and propagate a captive population of Cabot's Tragopan for re-establishing new populations into areas where the species formerly occurred, or for remnant wild population supplementation. A pilot supplementation test was carried out in the Wuyanling Nature Reserve in November 1991 (Ding and Zheng, 1996), but the long-term project was suspended due to the lack of stable source of breeding populations and genetic evaluation. It is now acknowledged that populations will not persist in the long term without reintroduction efforts using captive-bred individuals, to complement land management strategies aimed at increasing connectivity between isolated remnant populations and to improve the quality of breeding habitats at known sites (e.g. Zhang and Zheng, 2007). Assessing the genetic integrity of the remnant Wuyi-Yandang tragopan population and that of the captive population is therefore an important step for the long-term conservation management of this threatened species.

    We used nuclear genotypes to examine the genetic variation of both captive-bred and a remnant wild population of Cabot's Tragopan to help inform reintroduction strategies. Microsatellites represent a kind of highly polymorphic nuclear markers to make a comprehensive risk assessment of genetic variation for endangered species (Ellegren, 2004). First, we developed a polymorphic primer set including three novel loci isolated from Cabot's Tragopan and 12 loci developed from cross-species amplification of three Galliformes species. Then 158 individuals were genotyped on these loci to compare inbreeding coefficients between target populations.

    A total of 142 blood and feather samples were obtained from the TBCBNU. As well, 16 feather samples were collected from the remnant wild Wuyi-Yandang population. The smaller sample size from the wild population was simply a reflection of the difficulty in capturing a larger number of this furtive and low density species — a situation typical for many of China's endemic Galliformes. All samples were stored in 95% ethanol solutions.

    Genomic DNA was extracted from all samples using a standard protocol involving proteinase K digestion, followed by phenol/chloroform separation and precipitation with ethanol (Sambrook et al., 1989). We evaluated microsatellite loci, originally identified from 56 published primers of three Galliformes species: Turkey (Meleagris gallopavo) (Burt et al., 2003), Red Junglefowl (Gallus gallus) (Crooijmans et al., 1997) and the Brown Eared-pheasant (Crossoptilon mantchuricum) (Zhao, 2007). Meanwhile, microsatellites were isolated using an enriched genomic library from muscle sample of an adult male at TBCBNU. Linked genomic fragments were enriched using (CAG)10, (GAAA)10 or (GATA)10 biotinylated probes and plasmid DNAs from 51 positive clones were sequenced following Hsu et al. (2003). Primer pairs were designed for nine sequences, where tandem repeat sequences existed.

    Polymerase chain reactions (PCR) was carried out using DNA from one adult male from TBCBNU for the nine primer sets isolated from the genomic library and 56 published primer sets together. PCR was performed using a 10 μL reaction mixture consisting of 1 μL genomic template DNA (about 15 ng), 1 × PCR buffer containing 0.3 mmol·L–1 each dNTP, 1.5 mmol·L–1 MgCl2, 0.2 μmol·L–1 each primer and 1 U Taq polymerase (Trans Gene). PCR amplification was conducted in a MJ Research PT-200 thermo cycler for 5 min at 94℃, followed by 35 cycles of 30 s at 94℃, 30 s at gradient annealing temperature (45–55℃), 30 s at 72℃ and completed with 10 min elongation at 72℃. We successfully amplified PCR products from 44 primer pairs. After loci were successfully sequenced, 26 of them were found to contain at least five repeat motifs. We screened these loci in 16 wild Cabot's Tragopans using ABI (Applied Biosystems) 3100 automated sequencer with forward primers labeled with 6-FAM or HEX fluorescent dye. Genotyping was carried out using GeneMapper 3.7 (Applied Biosystems), with ET-ROX 500 as internal size standard. In total, we identified three novel variable microsatellite loci for Cabot's Tragopan and a further 12 polymorphic microsatellite loci by cross-species amplification.

    All 15 primer pairs were used to amplify the samples from both populations. All PCRs were carried out in a 10 μL reaction mixture consisting of 50 ng of template, 0.2 mmol·L–1 each primer, 1 × PCR amplification buffer (Takara), 2 mmol·L–1 MgCl2, 0.15 mmol·L–1 each dNTP and 1 U Taq DNA polymerase (Takara), using a PTC-200 thermocycler (MJ Research). The following conditions prevailed: denaturation at 94℃ for 5 min followed by 35 cycles at 94℃ for 30 s, annealing temperature (see Table 1) for 30 s and 72℃ for 30 s, with a final extension at 72℃ for 10 min. Genotyping of the PCR products was conducted on an ABI (Applied Biosystems) 3100 automated sequencer. The results were analyzed using ABI PRISM GeneMapper software, version 3.0 (Applied Biosystems).

    Table  1.  Principal characteristics of microsatellite loci in wild Tragopan caboti individuals (n = 16). Ta = optimum annealing temperature; Size range = allele size range; Na = number of observed alleles; PIC = polymorphic information content; p = probability test for deviation from Hardy-Weinberg equilibrium (HWE); Loci with significant deviation from HWE (p = 0.003 with Bonferroni correction) are highlighted in bold.
    Locus Repeat motif Primer sequence (5′→ 3′) Ta (℃) Size range (bp) Na PIC p Reference
    C52 (TAGA)12 F: TCCTGATGTGGCAGAGCAGAGG
    R: CTAACAAACAGTGTGTTATTGTGG
    49 174–198 7 0.74 0.835 This study
    C76 (TATC)9 F: CAGACTGCATATGGCACTGTTG
    R: GCATGTCAGAATTCACCTGC
    55 240–252 4 0.59 0.426 This study
    C228 (CTCTTT)3(GAA)9 F: CAGAGAATAGATTAAGGGATAAGA
    R: AAACATAGATGGTAGCACTCCCT
    55 174–179 2 0.27 1.000 This study
    5A8 (AAAC)5 F: GATCCAGGGGGTGTGCACACG
    R: CAGCCCGCACGGATGGTG
    48 258–262 2 0.35 1.000 Zhao, 2007
    5H7 (TG)27 F: CCAAGAGGGAGGCACACGTTC
    R: AGCCATAAATAAGCAAACGC
    48 185–219 12 0.87 < 0.003 Zhao, 2007
    5H8 (TAGAA)8 F: TCCCTGCCAAATACATTGCA
    R: CTGTTTCCATACCAAGACGCTG
    44 129–169 9 0.81 0.869 Zhao, 2007
    RHT0010 (AC)10 F: TTAACCTATCAGGTCGTTGCG
    R: GCATGTCAGAATTCACCTGC
    55 185–187 2 0.34 1.000 Burt et al., 2003
    RHT0047 (AC)13 F: AGACCAGGTGGACCCAGAG
    R: TTTGGCATCTACATTTGCTCC
    57 225–241 7 0.73 0.605 Burt et al., 2003
    RHT0079 (AC)9 F: TGTTCTTCACTGTTCTTGCAGG
    R: AGCAGTAATTCACAGCCTTCTC
    55 208–216 4 0.46 1.000 Burt et al., 2003
    RHT0263 (AC)9 F: AGAACTGCACACAATGCAGC
    R: TCCACATGACAAACTGGATAGC
    55 305–317 3 0.31 0.398 Burt et al., 2003
    ADL142 (AC)9TA(AC)7 F: CAGCCAATAGGGATAAAAGC
    R: CTGTAGATGCCAAGGAGTGC
    55 202–206 3 0.53 0.412 http://www.ncbi.nlm.nih.gov
    ADL184 (AC)13 F: GCCTCCTCACCCACAAAACC
    R: TCAGTAACACCACGAATGCC
    55 122–142 10 0.81 < 0.003 http://www.ncbi.nlm.nih.gov
    ADL230 (AC)9 F: GCCAAATAGTAATCCACTGC
    R: TCGCTCTTGCCATTGTAAGT
    51 103–115 5 0.64 0.960 http://www.ncbi.nlm.nih.gov
    MCW98 (AC)17 F: GGCTGCTTTGTGCTCTTCTCG
    R: CGATGGTCGTAATTCTCACGT
    53 244–258 4 0.67 < 0.003 http://www.ncbi.nlm.nih.gov
    MCW146 (AC)9 F: CCGTGTGGTGAACAACGATGA
    R: CAAATCTGCCCTGACGTCAGC
    55 134–142 3 0.29 0.524 Crooijmans et al., 1997
    Mean/Total 5.13 0.56
     | Show Table
    DownLoad: CSV

    We assessed the number of alleles (Na), observed (HO), expected heterozygosity (HE) and exact tests for possible deviations from the Hardy-Weinberg equilibrium (HWE) for each of the fifteen loci by ARLEQUIN version 3.1 (Excoffier et al., 2005). We used MICRO-CHECKER version 2.2.3 (Van Oosterhout et al., 2004), to estimate null allele frequencies following Brookfield (1996). The pair-wise linkage (genotypic) disequilibrium among microsatellite loci was evaluated by ARLEQUIN v3.1 as well. To reduce the probability of Type 1 errors in multiple tests, Bonferroni corrections (Rice, 1989) were applied in the calibration to reject the null hypothesis. Polymorphic information content (PIC) was used as a general estimate of polymorphism for all microsatellite loci used in the linkage analysis (e.g. Botstein et al., 1980; Shete et al., 2000). We used the inbreeding coefficient index FIS (Weir and Cockerham, 1984) as a measure of the degree of inbreeding from the Hardy-Weinberg equilibrium within population by estimating homozygosity excess (FIS = 1−HO/HE, where HO is the average observed heterozygosity within a subpopulation and HE is the average expected heterozygosity within a subpopulation). For a population which is in Hardy-Weinberg equilibrium, the estimates of observed and expected heterozygosity are equal (FIS = 0), whereas the value of FIS should be positive for populations that have experienced inbreeding which induced a certain extant deficiency of heterozygosity. FIS for all three populations was calculated using locus-by-locus AMOVA block implemented in ARLEQUIN version 3.1.

    The principal genetic characteristics of 15 microsatellite loci in the Wuyi-Yandang population are shown in Table 1. The number of alleles per locus ranged from 2 to 12, with a mean of 5.13 alleles. There was considerable variation in the estimates of polymorphism across loci based on PIC values, ranging from 0.27 to 0.87. Three loci, 5H7, MCW98 and ADL184 significantly deviated from the HWE with Bonferroni correction (p = 0.0033) and were removed from subsequent analyses. MICRO-CHECKER analysis revealed that the three loci with null allele, 5H7, MCW98 and ADL184, in accord with the three loci which deviated from HWE. Of the remaining 12 loci, there was no evidence of linkage disequilibrium with Bonferroni corrections, confirming the suitability of this suite of polymorphic microsatellites to assess the genetic differentiation between the captive populations and the wild population.

    Both observed and expected heterozygosity were similar across loci for the TBCBNU population and the Wuyi-Yandang population (Table 2). There were no significant differences between HO and HE for each locus across the two populations (Table 2). The value of FIS of the TBCBNU captive population was negative (–0.05), but was not significantly different from zero (p = 0.996), suggesting that there was no inbreeding within the TBCBNU captive population. Neither was there any evidence of inbreeding within the wild Wuyi-Yandang population (FIS = 0.05, p = 0.192).

    Table  2.  Genetic diversity comparison of 12 microsatellite loci in two populations of Tragopan caboti: HO = observed heterozygosity; HE = expected heterozygosity; FIS = inbreeding coefficient index. Numbers in parenthesis indicate sample size for each population.
    Captive population (TBCBNU, n = 142) Wild population (Wuyi-Yandang, n = 16)
    HO HE HO HE
    C52 0.81 0.76 0.71 0.76
    C76 0.30 0.47 0.46 0.58
    C228 0.21 0.22 0.47 0.47
    5A8 0.52 0.46 0.44 0.42
    5H8 0.89 0.77 0.79 0.83
    RHT0010 0.48 0.44 0.21 0.20
    RHT0047 0.58 0.59 0.77 0.76
    RHT0079 0.45 0.49 0.46 0.52
    RHT0263 0.28 0.33 0.42 0.54
    ADL142 0.66 0.58 0.71 0.58
    ADL230 0.78 0.70 0.79 0.70
    MCW146 0.31 0.31 0.31 0.38
    Overall 0.56 0.54 0.51 0.60
    FIS –0.05 (p = 0.996) 0.05 (p = 0.192)
     | Show Table
    DownLoad: CSV

    In this study we developed twelve microsatellite primers with high polymorphism for Cabot's Tragopan that greatly improved our capacity to understand many ecological characteristics of this threatened species (mating systems, dispersal ability, sperm competition, etc). These primers are also beneficial for future research in conservation genetics, such as the effect of habitat fragmentation on genetic diversity and gene flow restriction between wild populations, but also for monitoring and evaluation of conservation program implementation. We used two different approaches to develop polymorphic microsatellite loci in Cabot's Tragopan, but both were less efficient than those used in other species (Barbará et al., 2007). However, the same loci did show higher levels of polymorphism in 15 Temminck's Tragopans (T. temminckii) collected from one population (unpublished data), which revealed lower genetic diversity in Cabot's Tragopan. We suggest that more primers with higher polymorphism should be developed that would enable more comprehensive genetic diversity monitoring protocols for captive stock and remnant wild populations.

    We have shown that assessing the genetic integrity of wild and captive bred populations is an essential component of reintroduction programs of threatened species. Our non-significant FIS value in the TBCBNU and Wuyi-Yandang populations (Table 2) revealed no evidence of inbreeding in either the captive or wild target populations in the present study. For the TBCBNU population, the outcome could be attributed to the origins of captive population establishment and subsequent management methods. The number of TBCBNU founders was large (n = 19) and were introduced in stages from three different wild populations: Hunan, Wuyi-Yandang and Guangxi. Efforts were also made to increase the chances of random mating at TBCBNU by artificial fertilization (Zhang, 2006), which to a degree, helped to reduce the probability of inbreeding. Thus, the individuals from the TBCBNU stock are suitable candidates for Cabot's Tragopan reintroduction programs, whether the purpose is to re-establish a new population in an area where Cabot's Tragopan once existed, or to supplement an existing remnant wild population, since both projects require the selection and use of healthy individuals with similar genetic backgrounds. We stress the importance of determining whether the 'source' of birds for reintroduction will be detrimental to the genetic basis of either the new founder or the extant remnant population (World Pheasant Association and IUCN/SSC Re-introduction Specialist Group, 2009).

    For the small and isolated remnant wild Wuyi-Yandang population, the high FIS values are encouraging since previous PVA analysis has shown that removing the risk of inbreeding depression from this population significantly reduces the risk of its local extinction (Zhang and Zheng, 2007). Nevertheless, we exercise some concern over whether the degree of ongoing habitat fragmentation in the region may have had a 'debt' impact on the genetic diversity of T. caboti, which has yet to manifest itself. Although microsatellite markers have faster mutation rates than the large majority genetic markers (Ellegren, 2004), detection of reduced genetic variation in small isolated populations via genetic drift may not be detectable until the population has undergone at least ten or twenty generations.

    These studies should also explicitly consider using both mitochondrial DNA as a scale for the evolutionary history of the species and microsatellite loci as a scale for isolation and gene flow during recent geological periods. Such an approach would enable better monitoring of the captive population to establish clear genetic lineages amongst them and allow a more comprehensive assessment of the potential for genetic restoration and/or maintenance of isolated remnant wild populations.

    Our results have a number of implications for conservation management for Cabot's Tragopan. First, we have shown that any future establishment of captive T. caboti populations for the purpose of reintroduction should focus on careful screening and use of wild birds as potential founders. Second, wild individuals from e.g. the Wuyi-Yandang population could also be introduced to supplement the genetic integrity of captive populations, but we stress that this should not be done at the expense of efforts to conserve the wild population.

    In this study we have identified that a particular captive stock — the TBCBNU population — is a suitable candidate for T. caboti reintroduction programs. Currently there is a proposal for re-establishing a T. caboti population at one of the few remaining isolated locations. We strongly encourage the proponents of this proposal to follow closely the current IUCN reintroduction guidelines (World Pheasant Association and IUCN/SSC Re-introduction Specialist Group, 2009): appropriate project 'success' indicators must be identified; suitable monitoring protocols must be agreed upon to enable monitoring the genetic diversity of wild populations using non-invasive sampling; ensure that the principal causes of local population extinction (over-hunting and selective logging) are no longer relevant, prior to releasing individuals into the wild.

    We would like to thank the Wuyishan National NR (Jiangxi) and the Wuyanling National NR, for their support in sample collections. This study was supported by the National Key Technology R & D Program of China (No. 2008BAC39B05) and the National Natural Science Foundation of China (No. 30670289)

    We are particularly thankful to all the bird watching enthusiasts who offered photographs of cuckoos and their hosts. We thank Jeremy Wilson, the editor of Ibis, Andrew MacColl, associate editor of Ibis and two anonymous referees of Ibis for providing helpful comments on this manuscript. This work was supported by the National Natural Science Foundation of China (No. 31071938, 31101646), Key Project of Chinese Ministry of Education (No. 212136), the China Postdoctoral Science Foundation funded project (20110490967) and the Program for New Century Excellent Talents in University (NCET-10-0111). We thank the Forestry Department of Guizhou Province and the Kuankuoshui National Nature Reserve for support and permission to carry out this study, as well as X. Guo, L. Wang, X. Xu, N. Wang and T. Su for assistance with the field work.

  • Ali S, Ripley SD. 1974. Handbook of the Birds of India and Pakistan, Together with Those of Nepal, Sikkim, Bhutan and Ceylon. Oxford University Press, Bombay.
    Antonov A, Avilés JM, Stokke BG, Spasova V, Vikan JR, Moksnes A, Yang C, Liang W, Røskfat E. 2011. Egg discrimination in an open nesting passerine under dim light conditions. Ethology, 117: 1128–1137.
    Baker ECS. 1906. The oology of Indian parasitic cuckoos (Part II). J Bombay Nat His Soc, 17: 351–374.
    Baker ECS. 1907. Additional cuckoo notes. J Bombay Nat His Soc, 17: 876–894.
    Baker ECS. 1919. Some notes on the genus Surniculus. Novitates Zool, 26: 291–294.
    Baker ECS. 1927. The Fauna of British India Including Ceylon and Burma. Taylor and Francis, Longdon.
    Baker ECS. 1934. The Identification of Birds of the Indian Empire. Taylor and Francis, London.
    Baker ECS. 1942. Cuckoo Problems. H. F. and G. Witherby, London.
    Becking JH. 1981. Notes on the breeding of Indian cuckoos. J Bombay Nat His Soc, 78: 201–231.
    Begum S, Moksnes A, Røskaft E, Stokke BG. 2012. Responses of potential hosts of Asian cuckoos to experimental parasitism. Ibis, 154: 363–371.
    Begum S, Moksnes A, Røskaft E, Stokke BG. 2011a. Interactions between the Asian Koel (Eudynamys scolopacea) and its hosts. Behaviour, 148: 325–340.
    Begum S, Moksnes A, Røskaft E, Stokke BG. 2011b. Factors influencing host nest use by the brood parasitic Asian Koel (Eudynamys scolopacea). J Ornithol, 152: 793–800.
    Bu F, Zhang L, Ren B. 1999. Breeding ecology of Indian Cuckoo in Xiaodian area of Taiyuan city, Shanxi Province. Shanxi Forest Sci Technol, 3: 36–38. (in Chinese)
    Carey GJ, Chalmers ML, Diskin DA, Kennerley PR, Leader PJ, Leven MR, Lewthwaite RW, Melville DS, Turnbull M, Young L. 2001. The Aviafauna of HongKong. Hong Kong Bird Watching Society, Hong Kong.
    Cheng TS, Xian Y, Guan G. 1991. Fauna Sinica: Aves, Columbiformes, Psittaciformes, Cuculiformes and Strigiformes. Science Press, Beijing. (in Chinese)
    Cheng TS. 1963. Resource fauna of China. Aves. Beijing: Science Press. (in Chinese)
    Cheng TS. 1973. Avifauna of Qingling Mountain. Science Press, Beijing. (in Chinese)
    Cherry MI, Bennett ATD. 2001. Egg colour matching in an African cuckoo as revealed by ultraviolet-visible reflectance spectrophotometry. Proc R Soc Lond B, 268: 565–571.
    Fan L, Liu R, Song Q. 2000. Breeding ecology of Large-Hawk cuckoo in Lishan Nature Reserve, Shanxi Province. Sichuan J Zool, 19: 85–86. (in Chinese)
    Fu T, Gao W, Song Y. 1984. Birds of Changbai Mountain. Northeastern China Normal University Press, Jilin. (in Chinese)
    Gao W. 2004. The Ecology of Cavity-nesting Birds of Northeastern China. Jilin Science and Technology Press, Jilin. (in Chinese)
    Gao W, Yang Z, Luo W. 1990. Observation on breeding behavior of three bird species. Chinese Wildl, 4: 10–11. (in Chinese)
    Guangdong Institute of Entomology, Sun Yat-sen University. 1983. Birds and Mammals of Hainan Island. Science Press, Beijing. (in Chinese)
    Hao S, Wang Y. 1992. Breeding ecology of the Oriental Reed Warbler. Shandong Forest Sci Technol, 1: 20–22. (in Chinese)
    Harrison CJO. 1969. The identification of the eggs of the smaller Indian cuckoos. J Bombay Nat His Soc, 66: 478–488.
    Hellebrekers WPJ, Hoogerwerf A. 1967. A further contribution to our oological knowledge of the island of Java (Indonesia). Zool Verhand, 88: 1–164.
    Higuchi H. 1989. Responses of the bush warbler Cettia diphone to aritifical eggs of Cuculus cuckoos in Japan. Ibis, 131: 94–98.
    Higuchi H. 1998. Host use and egg color of Japanese cuckoos. In: Rothstein SI, Robinson SK (eds) Parasitic Birds and Their Hosts: Studies in Coevolution. Oxford University Press, New York, pp 80–93.
    Hoogerwerf A. 1949. Bijdrage tot de Oölogie van Java. Limosa, 22: 1–279.
    Hornskov J. 1995. Recent observations of birds in the Philippine Archipelago. Forktail, 11: 1–10.
    Hume AO. 1873. Nest and Eggs of Indian Birds, Rough Draft. Office of Superintendent of Government Printing, Calcutta.
    Jia C, Liang W, Gong H. 2007. Chestnut-winged Cuckoo parasitized the Hwamei. Chinese J Zool, 42: 38. (in Chinese)
    Jiang Y, Liang W, Yang C, Sun Y. 2006. Lesser Cuckoo parasitized the Brownish-flanked Bush Warbler. Chinese J Zool, 5: 31. (in Chinese)
    Jiang Y, Liang W, Yang C, Sun Y. 2007. Large Hawk-cuckoo parasitized the White-browed Laughingthrush. Sichuan J Zool, 26: 509. (in Chinese)
    La Touche JDD. 1931-34. A Handbook of the Birds of Eastern China. Taylor and Francis, London.
    Lewthwaite RW. 1996. Forest Birds of Southeastern China: Observations during 1984–1996. Hong Kong Bird Report, Hong Kong.
    Li G. 1985. Fauna of Sichuan Province. Vol. 3: Birds. Sichuan Science and Technology Press, Chengdu. (in Chinese)
    Lin RX. 2008. Observation of Oriental Cuckoo parasitism on Rufous-capped Babbler in central Taiwan. Nat Conserv Q, 64: 58–62. (in Chinese)
    Liu H, Feng J, Su H. 1984. Observation on egg-laying of the common cuckoo. Sichuan J Zool, 3: 14–16. (in Chinese)
    Liu H, Su H, Shen S, Lan Y, Ren J, Wu W. 1988. Breeding ecology of the Eurasian Wren in Guandi Mountain, Shanxi Province. Chinese J Zool, 23: 8–12. (in Chinese)
    Liu X, Long G. 1986. Breeding behavior of the Light-vented Bulbul. Chinese J Zool, 5: 12–15. (in Chinese)
    Lu X. 1988. Common cuckoo parasitism on the oriental reed warbler. Sichuan J Zool, 7: 21–22. (in Chinese)
    Mackenzie JMD. 1918. Some further notes on cuckoos in Maymyo. J Bombay Nat His Soc, 25: 742–745.
    MacKinnon J, Phillipps K. 1999. A Field Guide to the Birds of China. Oxford University Press, Oxford.
    Moksnes A, Røskaft E, Tysse T. 1995. On the evolution of blue cuckoo eggs in Europe. J Avian Biol, 26: 13–19.
    Nakamura H, Kubota S, Suzuki R. 1998. Coevolution between the common cuckoo and its major hosts in Japan. In: Rothstein SI, Robinson SK (eds) Parasitic Birds and Their Hosts: Studies in Coevolution. Oxford University Press, New York, pp 94–112.
    Neufeldt I. 1971. Der Kurzflügelsänger Horeites diphone (Kittlitz). Falke, 18: 364–375.
    Osmaston AE. 1912. Eggs of the large hawk-cuckoo (Hierococcyx sparverioides). J Bombay Nat His Soc, 21: 1330–1331.
    Osmaston BB. 1916. Notes on cuckoos in Maymyo. J Bombay Nat His Soc, 24: 359–363.
    Payne RB. 2005. The Cuckoos. Oxford University Press, Oxford.
    Qian Y, Zhang J. 1965. Birds and Mammals of Southern Xinjiang. Science Press, Beijing. (in Chinese)
    Rothstein SI, Robinson SK. 1998. Parasitic Birds and Their Hosts: Studies in Coevolution. Oxford University Press, New York.
    Sheldon FH, Moyle RG, Kennard J. 2001. Ornithology of Sabah: history, gazetteer, annotated checklist, and bibliography. Ornithol Monogr, 52: 1–285.
    Smythies BE. 1957. An annotated checklist of the birds of Borneo. Sarawak Museum J, 9: 523–818.
    Smythies BE. 1999. The Birds of Borneo. 4th edn. Natural History Publications, Kota Kinabalu.
    Stevens H. 1925. Notes on the birds of the Sikkim Himalayans. J Bombay Nat His Soc, 30: 664–685.
    Tian F, Song Y, Hao S, Feng Z, Wang Y. 1991. Notes on ecology of the common cuckoo in Nansi Lake. Shandong Forest Sci Technol, 1: 9–12. (in Chinese)
    Vaughan RE, Jones KH. 1913. The Birds of Hong Kong, Macao and the West River or Si Kiang in South-East China, with special reference to their identification and seasonal movements. Ibis, 10: 17–384.
    Wang H, Jiang Y, Gao W. 2011. Jankowski's bunting (Emberiza jankowskii): current status and conservation. Chinese Birds, 1: 251–258.
    Wang Z, Jia C, Sun Y. 2004. Parasitized breeding and nestling growth in oriental cuckoo. Chinese J Zool, 39: 103–105. (in Chinese)
    Wells DR. 1999. The Birds of the Thai-Malay Peninsula. Vol. 1, Non-passerines. Academic Press, New York.
    Yan A. 1985. Observation on Indian Cuckoo. Chinese Bull Biol, 3: 13. (in Chinese)
    Yang C, Antonov A, Cai Y, Stokke BG, Moksnes A, Røskaft E, Liang W. 2012. Large Hawk-cuckoo Hierococcyx sparverioides parasitism on the Chinese Babax Babax lanceolatus may be an evolutionarily recent host-parasite system. Ibis, 154: 200–204.
    Yang C, Cai Y, Liang W. 2008. Asian Emerald Cuckoo parasitized the Bianchi's Warbler Seicercus valentini. Chinese J Zool, 43: 74–75. (in Chinese)
    Yang C, Cai Y, Liang W. 2010a. Brood parasitism and egg mimicry on brownish-flanked bush warbler (Cettia fortipes) by lesser cuckoo (Cuculus poliocephalus). Zool Res, 31: 555–560. (in Chinese)
    Yang C, Cai Y, Liang W. 2011. Visual modeling reveals cryptic aspect in egg mimicry of Himalayan Cuckoo (Cuculus saturatus) on its host Blyth's Leaf Warbler (Phylloscopus reguloides). Zool Res, 32: 451–455.
    Yang C, Liang W, Cai Y, Shi S, Takasu F, Møller AP, Antonov A, Fossøy F, Moksnes A, Røskaft E, Stokke BG. 2010b. Coveolution in action: disruptive selection on egg colour in an avian brood parasite and its host. PLoS ONE, 5: e10816.
    Yoon MB. 2000. Wild Birds of Korea. Kyo-Hak, Seoul.
    Zhang J. 2001. Observation on the breeding habits of Dicrurus macrocercus. Chinese J Zool, 36: 60–63. (in Chinese)
    Zhang T. 1989. Studies on breeding ecology of the common cuckoo. Shandong Forest Sci Technol, 1: 24–26. (in Chinese)
    Zhang W. 1980. A Field Guide to the Birds of Taiwan. Insititue of Environmental Science, Tunghai University, Taiwan. (in Chinese)
    Zhao Z, He J. 1981. Studies on the breeding biology of blue-and-white flycatcher. Acta Zool Sin, 27: 388–394. (in Chinese)
    Zhao Z. 1985. The Avifauna of Changbai Mountain. Jilin Science and Technology Press, Jilin. (in Chinese)
    Zheng G. 2011. A Checklist on the Classification and Distribution of the Birds of China. 2nd edn. Science Press, Beijing.
    Zhou L, Song Y, Ma Y. 2001. Studies on breeding ecology of the balckbird. Chinese J Ecol, 20: 32–34. (in Chinese)
  • Related Articles

Catalog

    Figures(1)  /  Tables(3)

    Article Metrics

    Article views (4787) PDF downloads (3273) Cited by()

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return